ENSDARG00000010524

Ensembl ID:
ENSDARG00000010524
Human Orthologue:
EDEM3
Human Description:
ER degradation enhancer, mannosidase alpha-like 3 [Source:HGNC Symbol;Acc:16787]
Mouse Orthologue:
Edem3
Mouse Description:
ER degradation enhancer, mannosidase alpha-like 3 Gene [Source:MGI Symbol;Acc:MGI:1914217]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23886 Nonsense Mutation detected in F1 DNA During 2014
sa1899 Nonsense F2 line generated During 2014
sa13743 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024720 Nonsense 166 837 6 20

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 21 (position 11981563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGTTTGTTGGGTGCACATGTGATGGCTGATGTTTTGAAGCAGCGTGGA[C/T]AGAGAATGCAGTGGTACAGAGATGAACTGTTACACATGGCCAAAGAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1899
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024720 Nonsense 299 837 9 20

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 21 (position 11978776)
KASP Assay ID:
554-1889.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTTGGTGCTGGAATCGACTCTTATTATGAATACTTGATGAAAGCTTA[T/A]ATTCTTCTTGGGGACAAGGTGTACCTTGAGAGATTCAACACAGTACGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024720 Nonsense 417 837 13 20

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 21 (position 11976479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTAAATACCATTTCTGGCCTTGTTTTCWAGGCTACAGGTGATCCGTA[C/A]KACTTGAAAGTGGGCCAGTCTATAGTGGAGAAGCTGAACGCTCATGCTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hzxftvh1