per3

Ensembl ID:
ENSDARG00000010519
ZFIN ID:
ZDB-GENE-000804-1
Description:
period homolog 3 [Source:RefSeq peptide;Acc:NP_571659]
Human Orthologue:
PER3
Human Description:
period homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:8847]
Mouse Orthologue:
Per3
Mouse Description:
period homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1277134]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21969 Nonsense Available for shipment Available now
sa41903 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024304 Nonsense 293 1281 6 23

The following transcripts of ENSDARG00000010519 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 41458254)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 39717935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTACCATCAGGACGTCAATGTGTTTTACTCTCATACCGCACAGCCA[C/T]GACTGCCATCCTGGAACTTGGGCACAGACAGCGGTGAGTCTCTCTAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024304 Nonsense 1155 1281 21 23

The following transcripts of ENSDARG00000010519 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 41485188)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 39744869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCTCAGACACGTCCCGGAAAGCACGCAAATCCGCCGAGGCCCAGGAA[C/T]GAGAGCGAAGCGGCTTCAAGAAACATGTGGACGACCCTCTGTGGAGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link