dvl1a

Ensembl ID:
ENSDARG00000010515
ZFIN ID:
ZDB-GENE-090312-40
Human Orthologue:
DVL1
Human Description:
dishevelled, dsh homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3084]
Mouse Orthologue:
Dvl1
Mouse Description:
dishevelled, dsh homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:94941]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44013 Nonsense Mutation detected in F1 DNA During 2017
sa44014 Nonsense Mutation detected in F1 DNA During 2017
sa8764 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035755 Nonsense 179 729 5 15
ENSDART00000143583 Nonsense 21 569 1 11
Genomic Location (Zv9):
Chromosome 23 (position 30205106)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30039996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGTCACCCGAAATCGGAGCGTCTGAATCGTGACTCGGCAGTAGTTTA[T/A]GACAGTGCGTCTGTCATGAGCAGTGAACTGGAATCCAGCTCTTTTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035755 Nonsense 608 729 15 15
ENSDART00000143583 Nonsense 448 569 11 11
Genomic Location (Zv9):
Chromosome 23 (position 30230669)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30065559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATGGGTCACAAGAAGGGGTGAAAAAGCACCCAGTCAGCTGAGCCAC[C/T]AAAGCCACAGCCGATCGGCCGCCAGCCAGTCCCAATCCGCTTACAGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035755 Nonsense 641 729 15 15
ENSDART00000143583 Nonsense 481 569 11 11
Genomic Location (Zv9):
Chromosome 23 (position 30230770)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30065660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGCCACACACAGTGCCACCTCATCCCACAGCACAGCCTTAGCTTCAGCTA[C/A]AGCCATGCTCCATTCATCCAGCCCAGTCATCTGTCATGCGCCCACAGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link