hsp90a.1

Ensembl ID:
ENSDARG00000010478
ZFIN ID:
ZDB-GENE-990415-94
Description:
Heat shock protein HSP 90-alpha 1 [Source:UniProtKB/Swiss-Prot;Acc:Q90474]
Human Orthologues:
HSP90AB1, HSP90AB4P
Human Descriptions:
heat shock protein 90kDa alpha (cytosolic), class B member 1 [Source:HGNC Symbol;Acc:5258]
heat shock protein 90kDa alpha (cytosolic), class B member 4 (pseudogene) [Source:HGNC Symbol;Acc:32
Mouse Orthologue:
Hsp90ab1
Mouse Description:
heat shock protein 90 alpha (cytosolic), class B member 1 Gene [Source:MGI Symbol;Acc:MGI:96247]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1396 Nonsense F2 line generated During 2014
sa14009 Nonsense Available for shipment Available now
sa16631 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1396
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004756 Nonsense 413 725 7 11
Genomic Location:
Chromosome 20 (position 54342777)
KASP Assay ID:
554-1308.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAGAGYAAAATCCTGAAGGTGATCCGCAAAAACCTGGTCAAGAAGTG[T/A]CTCGATCTCTTCACCGAACTGGCAGAGGATAAAGACAACTAYAAGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004756 Nonsense 597 725 10 11
ENSDART00000004756 Nonsense 597 725 10 11
Genomic Location:
Chromosome 20 (position 54338757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCCAACCGTCTGGTGTCTTCGCCCTGCTGTATCGTCACCAGCAMATA[C/A]GGYTGGACGGCRAAMATGGAGAGGATCATGAAGTCTCAGGCTCTGAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004756 Nonsense 597 725 10 11
ENSDART00000004756 Nonsense 597 725 10 11
Genomic Location:
Chromosome 20 (position 54338757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCCAACCGTCTGGTGTCTTCGCCCTGCTGTATCGTCACCAGCAMATA[C/A]GGYTGGACGGCRAAMATGGAGAGGATCATGAAGTCTCAGGCTCTGAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/47eixmny