atp1a2a

Ensembl ID:
ENSDARG00000010472
ZFIN ID:
ZDB-GENE-001212-6
Description:
sodium/potassium-transporting ATPase subunit alpha-2 [Source:RefSeq peptide;Acc:NP_571758]
Human Orthologues:
ATP1A2, ATP1A4
Human Descriptions:
ATPase, Na+/K+ transporting, alpha 2 polypeptide [Source:HGNC Symbol;Acc:800]
ATPase, Na+/K+ transporting, alpha 4 polypeptide [Source:HGNC Symbol;Acc:14073]
Mouse Orthologues:
Atp1a2, Atp1a4
Mouse Descriptions:
ATPase, Na+/K+ transporting, alpha 2 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88106]
ATPase, Na+/K+ transporting, alpha 4 polypeptide Gene [Source:MGI Symbol;Acc:MGI:1351335]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9321 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33011 Nonsense Mutation detected in F1 DNA During 2016
sa33010 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39925 Nonsense Mutation detected in F1 DNA During 2016
sa18737 Nonsense Mutation detected in F1 DNA During 2016
sa11860 Nonsense Available for shipment Available now
sa39924 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Essential Splice Site 36 1017 2 24
ENSDART00000093298 Essential Splice Site 36 1017 2 25
Genomic Location (Zv9):
Chromosome 2 (position 44311661)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44397162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAAGAAGGATAAAGATTTAGATGAGCTGAAGAAAGAGGTGTCACTGG[T/A]AAGACRTTGTTATTTGGTCTGTGTGCCTACCGAAWATGTACTAATAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 146 1017 5 24
ENSDART00000093298 Nonsense 146 1017 5 25
Genomic Location (Zv9):
Chromosome 2 (position 44304778)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44390279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTCTGTCTGCTGTGGTCATCATAACCGGCTGCTTCTCATATTATCAA[G/T]AAGCCAAAAGCTCTCGGATCATGGACTCCTTCAAAAACATGGTGCCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Essential Splice Site 207 1017 6 24
ENSDART00000093298 Essential Splice Site 207 1017 6 25
Genomic Location (Zv9):
Chromosome 2 (position 44301943)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44387444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATCGAGTCCCCGCTGACCTGCGCATCATCTCCTCCAGTGGCTGCAAG[G/A]TAGACAGATATTACGTGCAGATCTGGGATCAGCTTTGCTTATTAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 349 1017 9 24
ENSDART00000093298 Nonsense 349 1017 9 25
Genomic Location (Zv9):
Chromosome 2 (position 44295861)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44381362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATCTCTCTCAGGTCTGCTTGACTCTGACAGCAAAGCGTATGGCTCGC[A/T]AAAACTGCCTGGTGAAGAATCTGGAAGCTGTGGAGACTTTGGGTTCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
Genomic Location (Zv9):
Chromosome 2 (position 44269683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44355184
KASP Assay ID:
2259-2551.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCCTCACCTTTCTTCTCTTGTTTTCTTCTTGCAGGATTATGTGGTG[G/A]TTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTATGATGAGATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
ENSDART00000011188 Nonsense 982 1017 23 24
ENSDART00000093298 Nonsense 982 1017 23 25
Genomic Location (Zv9):
Chromosome 2 (position 44269683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44355184
KASP Assay ID:
2259-2551.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTKTTCCTCACCTTTCTTCTCTTRTTTTCTTCTTGCAGGATTATGTGGTG[G/A]TTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTATGATGAGATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011188 Nonsense 995 1017 23 24
ENSDART00000093298 Nonsense 995 1017 23 25
Genomic Location (Zv9):
Chromosome 2 (position 44269644)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44355145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATGTGGTGGTTCTGTGCTTTCCCGTACAGTCTGCTTATCTTTGTGTA[T/A]GATGAGATCCGTAAGTTTATCCTGCGGAGAAATCCAGGAGGTGAGCACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link