nkx2.1a

Ensembl ID:
ENSDARG00000010461
ZFIN ID:
ZDB-GENE-000830-1
Description:
NK2 homeobox 1a [Source:RefSeq peptide;Acc:NP_571664]
Human Orthologue:
NKX2-4
Human Description:
NK2 homeobox 4 [Source:HGNC Symbol;Acc:7837]
Mouse Orthologue:
Nkx2-4
Mouse Description:
NK2 transcription factor related, locus 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97349]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23811 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007829 Nonsense 17 307 1 2
Genomic Location (Zv9):
Chromosome 20 (position 49081168)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48972114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTCCTTGAGCCCCAAACACTCAACGCCTTTCTCAGTGAGCGATATTT[T/A]GAGCCCGATCGAGGAGACCTTCAAGAAGTTTGCAGCCATGGAGAGCAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link