guca1a

Ensembl ID:
ENSDARG00000010454
ZFIN ID:
ZDB-GENE-011128-5
Description:
guanylyl cyclase-activating protein 1 [Source:RefSeq peptide;Acc:NP_571945]
Human Orthologue:
GUCA1A
Human Description:
guanylate cyclase activator 1A (retina) [Source:HGNC Symbol;Acc:4678]
Mouse Orthologue:
Guca1a
Mouse Description:
guanylate cyclase activator 1a (retina) Gene [Source:MGI Symbol;Acc:MGI:102770]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20274 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023588 Essential Splice Site 117 189 3 4
Genomic Location (Zv9):
Chromosome 4 (position 21284590)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22627925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACATTAAAGAAGAATGTTTTATTTTGGACTTATGCTTTATCTTATGTT[A/G]GGCCATTCGTGCCATCAATGGAAGCGAGACCCAGGAATCGAGCGCTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link