trabd

Ensembl ID:
ENSDARG00000010445
ZFIN ID:
ZDB-GENE-030131-1301
Description:
traB domain-containing protein [Source:RefSeq peptide;Acc:NP_997788]
Human Orthologue:
TRABD
Human Description:
TraB domain containing [Source:HGNC Symbol;Acc:28805]
Mouse Orthologue:
Trabd
Mouse Description:
TraB domain containing Gene [Source:MGI Symbol;Acc:MGI:1915226]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2982 Essential Splice Site F2 line generated During 2016
sa36599 Nonsense Mutation detected in F1 DNA During 2016
sa15109 Nonsense Available for shipment Available now
sa32193 Nonsense Available for shipment Available now
sa13996 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2982
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008035 Essential Splice Site 84 360 5 10
ENSDART00000145842 Essential Splice Site 83 103 5 5
Genomic Location (Zv9):
Chromosome 18 (position 14482414)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14927832
KASP Assay ID:
554-3321.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCAGCTGRTTGATCAAATGTTGTTTTKAATRAATGCTTYTTTTGCTTC[A/G]GACGATCCGAGCRGTCCAGCCTGATGTAGTAGTGGTGGAGCTGTGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008035 Nonsense 121 360 5 10
ENSDART00000145842   None 103 None 5
Genomic Location (Zv9):
Chromosome 18 (position 14482300)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14927718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTAAAATGGATGAGAAAACGCTGCTAAAAGAGGCTAAAGACATTAACT[T/A]GGAGAAGGTCCAGCAGGCCATTAAACAGGTCAGCCATGAGACGGAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008035 Nonsense 249 360 8 10
ENSDART00000145842   None 103 None 5
Genomic Location (Zv9):
Chromosome 18 (position 14477911)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14923329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGATGATCGGCGAGTTTCCAGCCCTCCACCGCACTATTGTWGCAGAA[C/T]GAGACATCTACCTCACACACACACTTCGACAGGCAGCGCGCTGTGTRGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008035 Nonsense 259 360 8 10
ENSDART00000145842   None 103 None 5
Genomic Location (Zv9):
Chromosome 18 (position 14477881)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14923299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCACTATTGTTGCAGAACGAGACATCTACCTCACACACACACTTCGA[C/T]AGGCAGCGCGCTGTGTAGAGGCGCCTCCTACTGCTGAGAGTGAGTACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008035 Essential Splice Site 304 360 9 10
ENSDART00000145842   None 103 None 5
Genomic Location (Zv9):
Chromosome 18 (position 14472525)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14917943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCGAGAGGAACTGGGATAAAGAGCTCAACATCCATGAAATCATGAGG[T/C]GCGTATCRGTATGGTACTTTGGTGCAATGTAAYACCAGATCTGTCATAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link