rnf11

Ensembl ID:
ENSDARG00000010442
ZFIN ID:
ZDB-GENE-040426-1277
Description:
ring finger protein 11 [Source:RefSeq peptide;Acc:NP_957315]
Human Orthologue:
RNF11
Human Description:
ring finger protein 11 [Source:HGNC Symbol;Acc:10056]
Mouse Orthologue:
Rnf11
Mouse Description:
ring finger protein 11 Gene [Source:MGI Symbol;Acc:MGI:1352759]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32771 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018817 Nonsense 121 146 3 3

The following transcripts of ENSDARG00000010442 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 52630135)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51501084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTTCCTGCCCTGCATGCACATCTATCACGTGGACTGCATCGATGCCTG[G/A]CTCATGCGCTCCTTCACTTGCCCCTCCTGTATGGAGCCGGTGGATGCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link