fam46c

Ensembl ID:
ENSDARG00000010437
ZFIN ID:
ZDB-GENE-030131-5365
Description:
Protein FAM46C [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUP1]
Human Orthologue:
FAM46C
Human Description:
family with sequence similarity 46, member C [Source:HGNC Symbol;Acc:24712]
Mouse Orthologue:
Fam46c
Mouse Description:
family with sequence similarity 46, member C Gene [Source:MGI Symbol;Acc:MGI:1921895]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38733 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023572 Nonsense 387 388 2 2
ENSDART00000032307   None 107 None 3
ENSDART00000139174 Nonsense 390 391 2 2
ENSDART00000142787   None 278 None 2
Genomic Location (Zv9):
Chromosome 9 (position 21816919)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20972705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTACTATGTGGCCTCTTGTAACCAGTCCATTCCAACTTGGTTGCCGTG[T/A]AACTAAGACACAAAGGATGCTTATTTGAAGACTAAATCCATCAGTTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link