arhgap44

Ensembl ID:
ENSDARG00000010433
Human Orthologue:
ARHGAP44
Human Description:
Rho GTPase activating protein 44 [Source:HGNC Symbol;Acc:29096]
Mouse Orthologue:
AU040829
Mouse Description:
expressed sequence AU040829 Gene [Source:MGI Symbol;Acc:MGI:2144423]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1827 Nonsense Available for shipment Available now
sa6916 Nonsense Mutation detected in F1 DNA During 2016
sa12914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 110 984 5 21
Genomic Location (Zv9):
Chromosome 3 (position 49868041)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44562461
KASP Assay ID:
554-1819.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTCTGCAGCAAGATGCTGAAGCTCTGTGGAGATACAGAGGAGAAGT[T/A]GGCCCAAGAGCTGCTCGTCTTTGAGCTTCAGATTGAAAGAGATGTCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 385 984 14 21
Genomic Location (Zv9):
Chromosome 3 (position 49850363)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44544783
KASP Assay ID:
554-5237.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAAACTGAAAGTTTTTTTTTTTCTCTCTCTCTCTTCCGAAACAGATA[T/G]TTAATCAAATTCTTATCCAAACTCACAGAGTACCAAGACTCTAATAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Essential Splice Site 452 984 15 21
Genomic Location (Zv9):
Chromosome 3 (position 49847268)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44541688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAATCATTGAGCCGATCATCCAGCACGCGGACTGGTTCTTCCCTGGAG[G/T]TTGGGACACAAAGAGTTGTGAAAACATATTCGCACATACAGGCGGGKGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link