arhgap44

Ensembl ID:
ENSDARG00000010433
Human Orthologue:
ARHGAP44
Human Description:
Rho GTPase activating protein 44 [Source:HGNC Symbol;Acc:29096]
Mouse Orthologue:
AU040829
Mouse Description:
expressed sequence AU040829 Gene [Source:MGI Symbol;Acc:MGI:2144423]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1827 Nonsense Available for shipment Available now
sa3467 Nonsense Mutation detected in F1 DNA During 2014
sa6916 Nonsense Mutation detected in F1 DNA During 2014
sa12914 Essential Splice Site Available for shipment Available now
sa5225 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 110 984 5 21
Genomic Location:
Chromosome 3 (position 49868041)
KASP Assay ID:
554-1819.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTCTGCAGCAAGATGCTGAAGCTCTGTGGAGATACAGAGGAGAAGT[T/A]GGCCCAAGAGCTGCTCGTCTTTGAGCTTCAGATTGAAAGAGATGTCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 369 984 13 21
Genomic Location:
Chromosome 3 (position 49851554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTTTCCTCTAGTATTCAGGAYATGGACAAAAGGCTTCAAGCCCTGT[T/A]GTGTACATGTGAGAAACTACCAGCAGACAATCTGAACAACTTCAGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 385 984 14 21
Genomic Location:
Chromosome 3 (position 49850363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAAACTGAAAGTTTTTTTTTTTCTCTCTCTCTCTTCCGAAACAGATA[T/G]TTAATCAAATTCTTATCCAAACTCACAGAGTACCAAGACTCTAATAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Essential Splice Site 452 984 15 21
Genomic Location:
Chromosome 3 (position 49847268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAATCATTGAGCCGATCATCCAGCACGCGGACTGGTTCTTCCCTGGAG[G/T]TTGGGACACAAAGAGTTGTGAAAACATATTCGCACATACAGGCGGGKGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056127 Nonsense 826 984 20 21
Genomic Location:
Chromosome 3 (position 49799178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGCCCCTGTGCCGCCCAAGGTTCCCTACGGCCAGTCGGGGGGGATGT[C/A]AGACCAATCCACAGGTCAGCCGTCTCCGGTTAGCCTGTCCCCCACTCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6caik1sp