npsn

Ensembl ID:
ENSDARG00000010423
ZFIN IDs:
ZDB-GENE-040420-2, ZDB-GENE-050318-7
Description:
nephrosin isoform 1 [Source:RefSeq peptide;Acc:NP_001071247]
Human Orthologue:
ASTL
Human Description:
astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
Mouse Orthologue:
Astl
Mouse Description:
astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34128 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12159 Nonsense Available for shipment Available now
sa40960 Nonsense Mutation detected in F1 DNA During 2017
sa15667 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017155   None 274 1 9
ENSDART00000109463   None 280 1 8
ENSDART00000138071 Essential Splice Site None 272 None 9

The following transcripts of ENSDARG00000010423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 40050504)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38387144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGAAGCATATAAAACTCTCAGCTCAGATTGACCCAGTTCATTTTTTC[A/G]GAAAGCTGTCATCATGTACCTGTTGGTAGTGGTCATCTCTCTTCTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017155 Nonsense 73 274 4 9
ENSDART00000109463 Nonsense 73 280 4 8
ENSDART00000138071 Nonsense 73 272 5 9

The following transcripts of ENSDARG00000010423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 40049339)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38385979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGRGAACACRGATGGGCCAGTAATMCTGTTTGGAGACATCRCCTTTCCC[A/T]GAGGTTTGCAGAATGCAGATCAATGTACAGCTCGTGGCTGCWAATGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017155 Nonsense 75 274 4 9
ENSDART00000109463 Nonsense 75 280 4 8
ENSDART00000138071 Nonsense 75 272 5 9

The following transcripts of ENSDARG00000010423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 40049332)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38385972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGATGGGCCAGTAATCCTGTTTGGAGACATCGCCTTTCCCAGAGGTT[T/A]GCAGAATGCAGATCAATGTACAGCTCGTGGCTGCAAATGGGACAGAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017155 Nonsense 87 274 4 9
ENSDART00000109463 Nonsense 87 280 4 8
ENSDART00000138071 Nonsense 87 272 5 9

The following transcripts of ENSDARG00000010423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 40049297)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38385937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTCCCWGAGGTTTGCAGAATGCAGATCAATGTACAGCTCGTGGCTGC[A/T]AATGGGACAGAAGCAGAGATGGATTAGTCTATGTGCCTTACCAGATMTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link