epn1

Ensembl ID:
ENSDARG00000010411
ZFIN ID:
ZDB-GENE-040426-2680
Description:
epsin 1 [Source:RefSeq peptide;Acc:NP_998527]
Human Orthologue:
EPN1
Human Description:
epsin 1 [Source:HGNC Symbol;Acc:21604]
Mouse Orthologue:
Epn1
Mouse Description:
epsin 1 Gene [Source:MGI Symbol;Acc:MGI:1333763]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9023 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22776 Nonsense Mutation detected in F1 DNA During 2014
sa22777 Missense, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013571 Essential Splice Site 229 636 7 12
ENSDART00000122250 None None 221 None 6
ENSDART00000124544 Essential Splice Site 229 636 9 14
ENSDART00000129449 None None 315 None 5
ENSDART00000132957 Essential Splice Site 171 237 6 8

The following transcripts of ENSDARG00000010411 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 14498909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGAGATCCGCTACGCACTCACAATCAGCCAGGAGACCCACCAACAG[G/A]TCAGGGAGCAAAAATTCATCCGGGTCACACCCTTGCTTTGCTGTCCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013571 Nonsense 326 636 9 12
ENSDART00000122250 None None 221 None 6
ENSDART00000124544 Nonsense 326 636 11 14
ENSDART00000129449 None None 315 None 5
ENSDART00000132957 None None 237 None 8

The following transcripts of ENSDARG00000010411 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 14500117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGCTGATCCTTGGGCAGGAGCACCAGCAACCGTAGCTCCAGACCCAT[G/A]GAGTGATTCGTCCTCCAGAGTAAATTCTGACCCCTGGGCATCCACAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013571 Nonsense 598 636 12 12
ENSDART00000122250 None None 221 None 6
ENSDART00000124544 Nonsense 598 636 14 14
ENSDART00000129449 Missense 235 315 4 5
ENSDART00000132957 None None 237 None 8

The following transcripts of ENSDARG00000010411 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 14506553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATATCCCCTATGGGTCCAGGAGGAAACCCCTTGCTGATGGGTCCAGGA[G/T]GACCTGCGCAGCCTTCACTGATTTTGGGCGGGCCATCAGGAGTGGGCGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tqiu207q