ppp4r4

Ensembl ID:
ENSDARG00000010407
ZFIN ID:
ZDB-GENE-041001-164
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RIH7]
Human Orthologue:
PPP4R4
Human Description:
protein phosphatase 4, regulatory subunit 4 [Source:HGNC Symbol;Acc:23788]
Mouse Orthologue:
Ppp4r4
Mouse Description:
protein phosphatase 4, regulatory subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1921771]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17042 Essential Splice Site, Missense Available for shipment Available now
sa1395 Essential Splice Site, Missense F2 line generated During 2017

Mutation Details

Allele Name:
sa17042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013861 Essential Splice Site 100 863 None 27
ENSDART00000141486 Missense 87 599 3 16
Genomic Location (Zv9):
Chromosome 20 (position 27382049)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27453352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCAGAACCCAGCAGAGACCTTYCGCAGGGTGGTGCCAAAAGTCAGGG[T/A]AGGGTAAATAATGGATSATTCATCGCTTCTTTTTATGARATCTTTTTRAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1395
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013861 Essential Splice Site 567 863 16 27
ENSDART00000141486 Missense 562 599 15 16
Genomic Location (Zv9):
Chromosome 20 (position 27395729)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27467032
KASP Assay ID:
554-1307.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTTCCTGCGCTATAACCGCAAACAAGAACAGCGGCAAGAGATAAT[G/A]AGTAAAATAAAACAAGGTAAAAAGAAAGAAAAATACTTATTTGACACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link