lrrfip2

Ensembl ID:
ENSDARG00000010400
ZFIN ID:
ZDB-GENE-030131-7781
Description:
leucine-rich repeat flightless-interacting protein 2 isoform 2 [Source:RefSeq peptide;Acc:NP_955773
Human Orthologue:
LRRFIP2
Human Description:
leucine rich repeat (in FLII) interacting protein 2 [Source:HGNC Symbol;Acc:6703]
Mouse Orthologue:
Lrrfip2
Mouse Description:
leucine rich repeat (in FLII) interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1918518]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3856 Nonsense Mutation detected in F1 DNA During 2014
sa4530 Nonsense F2 line generated During 2014
sa10914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022154 Nonsense 110 739 5 26
ENSDART00000099729 Nonsense 120 161 7 7
ENSDART00000099738 None None 405 None 13
ENSDART00000133848 None None 131 None 6

The following transcripts of ENSDARG00000010400 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 43302550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTTTTTCATTTCTTTCTACTTTTAAAGTCAAACTCATCATCTTTA[C/T]GAGACTTGAGCAGTTCTCATCGCTCTAGTCGGGGTAATTCTTCCAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4530
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022154 Nonsense 112 739 5 26
ENSDART00000099729 Nonsense 122 161 7 7
ENSDART00000099738 None None 405 None 13
ENSDART00000133848 None None 131 None 6

The following transcripts of ENSDARG00000010400 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 43302543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCATTTCTTTCTACTTTTAAAGTCAAACTCATCATCTTTAYGAGACT[T/A]GAGCAGTTCTCATCGCTCTAGTCGGGGTAATTCTTCCAGGAGAAGAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022154 Essential Splice Site 209 739 9 26
ENSDART00000099729 None None 161 None 7
ENSDART00000099738 None None 405 None 13
ENSDART00000133848 None None 131 None 6

The following transcripts of ENSDARG00000010400 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 43297579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCCATCCAGCAGCAGTTCTGCAGGTCTGACGCGAAGCTATAGTGTGG[T/C]TAGTCTGATTTTCATCACATGTGATTAAACCACACTGATCACATGTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8z79cstf