lrrfip2

Ensembl ID:
ENSDARG00000010400
ZFIN ID:
ZDB-GENE-030131-7781
Description:
leucine-rich repeat flightless-interacting protein 2 isoform 2 [Source:RefSeq peptide;Acc:NP_955773
Human Orthologue:
LRRFIP2
Human Description:
leucine rich repeat (in FLII) interacting protein 2 [Source:HGNC Symbol;Acc:6703]
Mouse Orthologue:
Lrrfip2
Mouse Description:
leucine rich repeat (in FLII) interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1918518]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4530 Nonsense F2 line generated During 2016
sa10914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4530
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022154 Nonsense 112 739 5 26
ENSDART00000099729 Nonsense 122 161 7 7
ENSDART00000099738   None 405 None 13
ENSDART00000133848   None 131 None 6

The following transcripts of ENSDARG00000010400 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43302543)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42523502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCATTTCTTTCTACTTTTAAAGTCAAACTCATCATCTTTAYGAGACT[T/A]GAGCAGTTCTCATCGCTCTAGTCGGGGTAATTCTTCCAGGAGAAGAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022154 Essential Splice Site 209 739 9 26
ENSDART00000099729   None 161 None 7
ENSDART00000099738   None 405 None 13
ENSDART00000133848   None 131 None 6

The following transcripts of ENSDARG00000010400 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 43297579)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42518538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCCATCCAGCAGCAGTTCTGCAGGTCTGACGCGAAGCTATAGTGTGG[T/C]TAGTCTGATTTTCATCACATGTGATTAAACCACACTGATCACATGTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link