sept4a

Ensembl ID:
ENSDARG00000010385
ZFIN ID:
ZDB-GENE-051120-87
Description:
septin 4a [Source:RefSeq peptide;Acc:NP_001032456]
Human Orthologue:
SEPT4
Human Description:
septin 4 [Source:HGNC Symbol;Acc:9165]
Mouse Orthologue:
Sept4
Mouse Description:
septin 4 Gene [Source:MGI Symbol;Acc:MGI:1270156]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13158 Nonsense Available for shipment Available now
sa37365 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14138 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006971 Nonsense 116 476 3 12
Genomic Location (Zv9):
Chromosome 21 (position 38368708)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39488787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTAWAATGATGTCATCKTTCTTTCTTTTAGGATCAGGATAAGGAGTA[T/A]GTTGGCTTTGCAACGCTGCCYAACCAAGTGCACAGGAAATCWGTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006971 Essential Splice Site 258 476 7 12
Genomic Location (Zv9):
Chromosome 21 (position 38362382)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39482461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACATAAATTTGTGAACATGACATTGCCTTTTCCCCTCTTTTTTTTCC[A/T]GTCTCAGACCAATTGATGTGGAGTTCATGAAGATTCTCCATGAGAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006971 Nonsense 465 476 12 12
Genomic Location (Zv9):
Chromosome 21 (position 38347501)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39467580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTTACAGTTGCGTCGAATGCAGGAGGTTCTGGAAAGGATTCARGAA[C/T]AGATGCGTCAAGGACATGAAGATTTACCCATTAATTRAARTGTATTTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link