rnf2

Ensembl ID:
ENSDARG00000010381
ZFIN ID:
ZDB-GENE-030131-5243
Description:
E3 ubiquitin-protein ligase RING2 [Source:UniProtKB/Swiss-Prot;Acc:Q803I4]
Human Orthologue:
RNF2
Human Description:
ring finger protein 2 [Source:HGNC Symbol;Acc:10061]
Mouse Orthologue:
Rnf2
Mouse Description:
ring finger protein 2 Gene [Source:MGI Symbol;Acc:MGI:1101759]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39814 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017034 Essential Splice Site None 336 1 7
Genomic Location (Zv9):
Chromosome 2 (position 22809141)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23695846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCACCAGAACGCGCTGGCAGGAGAGAGAGTGTTCACAACATTGAGATG[T/C]AAGTATGTAAACAGCTGCGTTTTTACTAAAATATATGCTTATTGCTTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link