si:ch211-132g1.5

Ensembl ID:
ENSDARG00000010376
ZFIN ID:
ZDB-GENE-090312-3
Description:
solute carrier family 5 (inositol transporters), member 3 [Source:RefSeq peptide;Acc:NP_001153309]
Human Orthologue:
SLC5A3
Human Description:
solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 [Source:HGNC Symbol;Acc:11038]
Mouse Orthologue:
Slc5a3
Mouse Description:
solute carrier family 5 (inositol transporters), member 3 Gene [Source:MGI Symbol;Acc:MGI:1858226]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18281 Nonsense Available for shipment Available now
sa10572 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008332 Nonsense 95 671 1 1
Genomic Location (Zv9):
Chromosome 1 (position 1782154)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1877574
KASP Assay ID:
2259-0067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCGGAGCTTGGGAATTTAATGCAATTCTCCTGCTRCAGCTCCTGGGCT[G/A]GGTCTTCATACCCGTCTACATCCACTCTGGAGTCTACACRATGCCAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008332 Nonsense 351 671 1 1
Genomic Location (Zv9):
Chromosome 1 (position 1782923)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1878343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGCATGCAAGTGTGCAACAGTAGAGCCGGTTGCACCAACACGGYRTA[T/A]CCTCGACTGGTCATGAACATCATGCCTGTGGGTCTTCGAGGATTGAWGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link