si:ch211-26b3.2

Ensembl ID:
ENSDARG00000010331
ZFIN ID:
ZDB-GENE-081104-212
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JL69]
Human Orthologue:
CXorf57
Human Description:
chromosome X open reading frame 57 [Source:HGNC Symbol;Acc:25486]
Mouse Orthologue:
D330045A20Rik
Mouse Description:
RIKEN cDNA D330045A20 gene Gene [Source:MGI Symbol;Acc:MGI:2147848]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20392 Nonsense Available for shipment Available now
sa33581 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080774 Nonsense 45 807 1 15
ENSDART00000131885 Nonsense 57 489 2 9
Genomic Location (Zv9):
Chromosome 5 (position 24620243)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22333115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCTCTGGACCGGTATCTGAGCTTTCAACATCCCGCAGCCCAGAGCTA[C/A]AGTTACGACCTGACGCTCACCGACGGCCGCTGGCGGATAAAGTGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080774 Essential Splice Site 321 807 4 15
ENSDART00000131885 Essential Splice Site 333 489 5 9
Genomic Location (Zv9):
Chromosome 5 (position 24622232)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22335104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGCCTCAGTGGGGTCTGCCTGAAGTTCCTTACAACTTTGCCACACGG[T/A]ATGCATAATCACTACTAACAAACATGTTTCTTTAATTCTTTGGTTTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link