qars

Ensembl ID:
ENSDARG00000010316
ZFIN ID:
ZDB-GENE-040426-1011
Description:
glutaminyl-tRNA synthetase [Source:RefSeq peptide;Acc:NP_957507]
Human Orthologue:
QARS
Human Description:
glutaminyl-tRNA synthetase [Source:HGNC Symbol;Acc:9751]
Mouse Orthologue:
Qars
Mouse Description:
glutaminyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1915851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41293 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17949 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023780 Essential Splice Site 233 437 8 14
ENSDART00000060919 Essential Splice Site 233 774 8 23
ENSDART00000115253 Essential Splice Site 256 797 8 23
ENSDART00000136602   None 224 None 7
ENSDART00000137472 Essential Splice Site 233 457 8 14
Genomic Location (Zv9):
Chromosome 8 (position 48530440)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46368698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATTGATGGAGCAGCTGAGAGGAGAAGCTCTTAAGTTCCATAAGCCAG[G/A]TAAGTGTCCTTAACGACTATGTGTCCAGATAGCTACAATGTCATTCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023780   None 437 None 14
ENSDART00000060919 Essential Splice Site 759 774 23 23
ENSDART00000115253 Essential Splice Site 782 797 23 23
ENSDART00000136602   None 224 None 7
ENSDART00000137472   None 457 None 14
Genomic Location (Zv9):
Chromosome 8 (position 48507330)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46345588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATTGAGTTTAACTTGTAWACTGTTTTTGYTTTGTTTTGTTCTYCA[G/A]CTGGTGTTCAACAGGACTGTTACACTCAAGGAGGATCCAGGAAAGATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link