cp

Ensembl ID:
ENSDARG00000010312
ZFIN ID:
ZDB-GENE-010522-1
Description:
ceruloplasmin [Source:RefSeq peptide;Acc:NP_571877]
Human Orthologue:
CP
Human Description:
ceruloplasmin (ferroxidase) [Source:HGNC Symbol;Acc:2295]
Mouse Orthologue:
Cp
Mouse Description:
ceruloplasmin Gene [Source:MGI Symbol;Acc:MGI:88476]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30734 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010537 Nonsense 618 1100 11 20
ENSDART00000104512   None 230 11 19
ENSDART00000104514   None 203 11 18
ENSDART00000121965   None 193 None 6
ENSDART00000126323   None 194 None 6
Genomic Location (Zv9):
Chromosome 22 (position 41150661)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38238300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAATTTCACCTTCTCGCAACTGTTTTCGATGAAAACCTAAGCTGGTA[T/A]TTGGATGACAACATCAACAGATATGCAAAGCAGCCCAAATCTGTGAATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link