b4galt6

Ensembl ID:
ENSDARG00000010301
ZFIN ID:
ZDB-GENE-040426-789
Description:
beta-1,4-galactosyltransferase 6 [Source:RefSeq peptide;Acc:NP_957232]
Human Orthologues:
B4GALT5, B4GALT6
Human Descriptions:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 [Source:HGNC Symbol;Acc:928]
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 [Source:HGNC Symbol;Acc:929]
Mouse Orthologues:
B4galt5, B4galt6
Mouse Descriptions:
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:192
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15321 Nonsense Available for shipment Available now
sa15173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013343 Nonsense 149 381 4 9
ENSDART00000147451 Nonsense 72 304 2 7

The following transcripts of ENSDARG00000010301 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 6229542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGAGACTCAAACATATGGAYATTCAATTYGGAGGCCACTGGAAGCCC[A/T]AAGATTGCAAACCACGCTGGAAGGYGAGTCACTGTTRTGATTTCATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013343 Nonsense 233 381 6 9
ENSDART00000147451 Nonsense 156 304 4 7

The following transcripts of ENSDARG00000010301 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 6227492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCTGGACTGGGACTGTGTGGTGTTTCACGACGTYGATCACATTCCA[G/T]AAAACGACCGTAATTACTACGGCTGTGGTCAGATGCCTCGACACTTCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dunincvy