b4galt6

Ensembl ID:
ENSDARG00000010301
ZFIN ID:
ZDB-GENE-040426-789
Description:
beta-1,4-galactosyltransferase 6 [Source:RefSeq peptide;Acc:NP_957232]
Human Orthologues:
B4GALT5, B4GALT6
Human Descriptions:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 [Source:HGNC Symbol;Acc:928]
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 [Source:HGNC Symbol;Acc:929]
Mouse Orthologues:
B4galt5, B4galt6
Mouse Descriptions:
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:192
UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15321 Nonsense Available for shipment Available now
sa36966 Nonsense Mutation detected in F1 DNA During 2016
sa15173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013343 Nonsense 149 381 4 9
ENSDART00000147451 Nonsense 72 304 2 7

The following transcripts of ENSDARG00000010301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 6229542)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6134816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGAGACTCAAACATATGGAYATTCAATTYGGAGGCCACTGGAAGCCC[A/T]AAGATTGCAAACCACGCTGGAAGGYGAGTCACTGTTRTGATTTCATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013343 Nonsense 187 381 5 9
ENSDART00000147451 Nonsense 110 304 3 7

The following transcripts of ENSDARG00000010301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 6229343)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6134617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCATTCTATTTCAGCACCTTACTCCAATGCTCCAACGCCAACGCTTG[C/T]AGTTTGCCTTTTATGTCATTGAACAGGTGAGCAAAGCAAGGTTTTTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013343 Nonsense 233 381 6 9
ENSDART00000147451 Nonsense 156 304 4 7

The following transcripts of ENSDARG00000010301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 6227492)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6132766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCTGGACTGGGACTGTGTGGTGTTTCACGACGTYGATCACATTCCA[G/T]AAAACGACCGTAATTACTACGGCTGTGGTCAGATGCCTCGACACTTCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link