traf3ip1

Ensembl ID:
ENSDARG00000010300
ZFIN ID:
ZDB-GENE-040426-1146
Description:
TRAF3-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PGZ3]
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC009021.1, AC010133.1, AC012596.1, AC016595.1, AC018553.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC092485.1, AC097714.1, AC116351.3, AL121899.1, AL138690.1, AL159986.1, AL357512.1, AL591242.1, TRAF3IP1
Human Description:
TNF receptor-associated factor 3 interacting protein 1 [Source:HGNC Symbol;Acc:17861]
Mouse Orthologues:
Gm10563, Traf3ip1
Mouse Descriptions:
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
TRAF3 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007189 Nonsense 353 629 7 15
ENSDART00000136444 None None 220 None 3
Genomic Location:
Chromosome 9 (position 46698363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTAAAGGACAGCGGCGGAAGCCCAAAACAGGAGGTCAAGGTACTGAA[C/T]AAGGTACTGAGCTGAACTGACTTTGTTAATTATTGATATACAATGCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Iris characteristics: GWAS findings for human iris patterns: associations with variants in genes that influence normal neuronal pattern development. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lpxbyv5a