KCNH6 (2 of 2)

Ensembl ID:
ENSDARG00000010296
Description:
potassium voltage-gated channel, subfamily H (eag-related), member 6 [Source:HGNC Symbol;Acc:18862]
Human Orthologue:
KCNH6
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 6 [Source:HGNC Symbol;Acc:18862]
Mouse Orthologue:
Kcnh6
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 6 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38874 Essential Splice Site Mutation detected in F1 DNA During 2017
sa5596 Nonsense F2 line generated During 2017
sa2657 Nonsense F2 line generated During 2017
sa31856 Essential Splice Site Available for shipment Available now
sa31857 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112507 Essential Splice Site 207 888 3 17
Genomic Location (Zv9):
Chromosome 12 (position 10083086)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9291041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTATATGATAATGAACCCTGTATGAAACTAACTATTATTAATTTTTGC[A/G]GACAACAGCCACTCTGATTGGCTTGCTGAAGACAGCCCGTCTGCTCCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5596
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112507 Nonsense 259 888 3 17
ENSDART00000112507 Nonsense 259 888 3 17
Genomic Location (Zv9):
Chromosome 12 (position 10083246)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9291201
KASP Assay ID:
554-3395.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTCATGTGCACCTTCGGGCTGATCGCTCATTGGTTGGCATGTATCTG[G/A]TATGCCATTGGCCATGTGGAGAGGCCATACATGAAAACAGGCTGGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2657
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112507 Nonsense 259 888 3 17
ENSDART00000112507 Nonsense 259 888 3 17
Genomic Location (Zv9):
Chromosome 12 (position 10083246)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9291201
KASP Assay ID:
554-3395.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTCATGTGCACCTTCGGGCTGATCGCTCATTGGTTGGCATGTATCTG[G/A]TATGCCATTGGCCATGTGGAGAGGCCATACATGAAAACAGGCTGGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112507 Essential Splice Site 554 888 6 17
Genomic Location (Zv9):
Chromosome 12 (position 10089672)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9297627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGAGAGCTTCTGGAGGAACCTGGAAATCACCTTTAACCTGCGAGATG[T/A]AGGAGATGTAATAATAGAAACACATTAGAAAAAGTTGGAGCAAATTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112507 Nonsense 712 888 14 17
Genomic Location (Zv9):
Chromosome 12 (position 10094198)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9302153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAACTGGCACACTCTTTTCTTCTTTTTTTTTTTAAGAAAATGAATA[T/G]GATTTAGATATTTAGTATGTTTGTTTTTCATAGTTGATCCTTGTAGTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link