si:dkey-219c10.5

Ensembl ID:
ENSDARG00000010280
ZFIN ID:
ZDB-GENE-081104-520
Description:
CLIP-associating protein 1 [Source:RefSeq peptide;Acc:NP_001108611]
Human Orthologue:
CLASP1
Human Description:
cytoplasmic linker associated protein 1 [Source:HGNC Symbol;Acc:17088]
Mouse Orthologue:
Clasp1
Mouse Description:
CLIP associating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1923957]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15630 Nonsense Available for shipment Available now
sa41484 Nonsense Mutation detected in F1 DNA During 2017
sa34705 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102445 Nonsense 14 1534 1 40
ENSDART00000131334   None 126 None 5
ENSDART00000137955 Nonsense 14 1492 2 38
ENSDART00000142853   None 63 None 3
Genomic Location (Zv9):
Chromosome 9 (position 39220360)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38358256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCRTAGRCCATGGAGCCCAATATGGAGTACTGTCTGACCCAGGTGCTA[C/T]AGAAGGATGTTGCRCGAAGGTTGCAGATGGGTCCGGAGCTCATCGACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41484
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102445 Nonsense 696 1534 21 40
ENSDART00000131334   None 126 None 5
ENSDART00000137955 Nonsense 685 1492 21 38
ENSDART00000142853   None 63 None 3
Genomic Location (Zv9):
Chromosome 9 (position 39308132)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38446028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCCGGCAGCCGATCCAGTTCACCAGGGAAGCTTTTGGGACATGCGTA[T/A]GGCAGAATTCCTAGAGCCACTGCGCCAACAACTCCCTCAGACAAGTACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102445 Nonsense 1272 1534 34 40
ENSDART00000131334   None 126 None 5
ENSDART00000137955 Nonsense 1217 1492 32 38
ENSDART00000142853   None 63 None 3
Genomic Location (Zv9):
Chromosome 9 (position 39330607)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38468503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCCAGAGAGTTTGCACCCTACGGCTATGGAGACACAATCACAGCCTA[T/A]GATAAAAGTGCCCTGAAAGAGGCCGTCTTTGATGACGATGTGGAGCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link