ptgs2b

Ensembl ID:
ENSDARG00000010276
ZFIN ID:
ZDB-GENE-041014-323
Description:
prostaglandin G/H synthase 2 [Source:RefSeq peptide;Acc:NP_001020675]
Human Orthologue:
PTGS2
Human Description:
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) [Source:HGNC S
Mouse Orthologue:
Ptgs2
Mouse Description:
prostaglandin-endoperoxide synthase 2 Gene [Source:MGI Symbol;Acc:MGI:97798]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29400 Nonsense Mutation detected in F1 DNA During 2017
sa23755 Nonsense Available for shipment Available now
sa13114 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010028 Nonsense 46 606 2 10
Genomic Location (Zv9):
Chromosome 20 (position 34151694)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34224207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCGAGGTGTCTGTACGGAAATGGGCTCCGACGCGTATGAATGTGACTG[T/A]ACACGGACTGGATATTACGGTCAAAACTGCACAACACGTAAGTGAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010028 Nonsense 102 606 3 10
Genomic Location (Zv9):
Chromosome 20 (position 34151436)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34223949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGTGGAATATTATCAACAACGTGTCGTTTCTGAGAAACGGCATAATG[C/T]GATACGTGCTGACATGTAAGTATAAAGCAGTCCCTCTTTTCCTGTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010028 Nonsense 598 606 10 10
Genomic Location (Zv9):
Chromosome 20 (position 34147134)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34219647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTAATGCAAGTACGTCCCAGTCAGATCGAAATGTCAACCCAACTGTTW[T/A]ACTAAAAGAAAGGACATCTGAGCTCTGATTAGTGTATTCTATTGTAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Knee osteoarthritis: Genome-wide association scan identifies a prostaglandin-endoperoxide synthase 2 variant involved in risk of knee osteoarthritis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link