igf2bp3

Ensembl ID:
ENSDARG00000010266
ZFIN ID:
ZDB-GENE-000308-1
Description:
Insulin-like growth factor 2 mRNA-binding protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q9PW80]
Human Orthologue:
IGF2BP3
Human Description:
insulin-like growth factor 2 mRNA binding protein 3 [Source:HGNC Symbol;Acc:28868]
Mouse Orthologue:
Igf2bp3
Mouse Description:
insulin-like growth factor 2 mRNA binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1890359]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6552 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36823 Nonsense Mutation detected in F1 DNA During 2017
sa43262 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Essential Splice Site 112 582 4 15
ENSDART00000133633 Essential Splice Site 62 110 5 7
Genomic Location (Zv9):
Chromosome 19 (position 20702340)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20635720
KASP Assay ID:
554-4598.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAGACGGGTTGTTAGCACAGTATGGCACAGTRGAAAGCTGTGAACAAG[G/A]TAAGATGYATTATTCAGCAAACARTCACTTGTATGGTAATTCAATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Nonsense 547 582 14 15
ENSDART00000133633   None 110 None 7
Genomic Location (Zv9):
Chromosome 19 (position 20722243)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20655623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTGATGAAAATGACCAAGTAGTAGTAAAAATCACAGGCCACTTCTA[T/G]GCAAGCCAGGTGATTGAGCTATTAGATGTTACTCTGCTTATGTAATGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010140 Essential Splice Site 550 582 14 15
ENSDART00000133633   None 110 None 7
Genomic Location (Zv9):
Chromosome 19 (position 20722254)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20655634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGACCAAGTAGTAGTAAAAATCACAGGCCACTTCTATGCAAGCCAGG[T/C]GATTGAGCTATTAGATGTTACTCTGCTTATGTAATGGGGTTCAAGAAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link