rpl22l1

Ensembl ID:
ENSDARG00000010244
ZFIN ID:
ZDB-GENE-060804-3
Description:
ribosomal protein L22-like 1 [Source:RefSeq peptide;Acc:NP_001038800]
Human Orthologue:
RPL22L1
Human Description:
ribosomal protein L22-like 1 [Source:HGNC Symbol;Acc:27610]
Mouse Orthologue:
Rpl22l1
Mouse Description:
ribosomal protein L22 like 1 Gene [Source:MGI Symbol;Acc:MGI:1915278]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15138 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079984 Nonsense 60 126 3 4
ENSDART00000129461 Nonsense 123 189 3 4
ENSDART00000136871 None None 42 3 4

The following transcripts of ENSDARG00000010244 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 27274063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGAAGGTGAAGGTTAATGGCAAAACAGGCAACCTGGGCAATGTAGTG[C/T]AAATTGTGCGTCAGARGAACAAGATCAACGTCACGTCAGAGAAGCAGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6w7lds21