eif4bb

Ensembl ID:
ENSDARG00000010194
ZFIN ID:
ZDB-GENE-030131-8563
Description:
eukaryotic translation initiation factor 4B [Source:RefSeq peptide;Acc:NP_999883]
Human Orthologue:
EIF4B
Human Description:
eukaryotic translation initiation factor 4B [Source:HGNC Symbol;Acc:3285]
Mouse Orthologue:
Eif4b
Mouse Description:
eukaryotic translation initiation factor 4B Gene [Source:MGI Symbol;Acc:MGI:95304]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20761 Nonsense Mutation detected in F1 DNA During 2014
sa9211 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021520 Nonsense 64 569 3 13
ENSDART00000045775 Nonsense 64 632 3 15
ENSDART00000127365 None None 128 None 5
ENSDART00000128308 Nonsense 64 632 3 15

The following transcripts of ENSDARG00000010194 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 39006487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTCCTCTATAGTTTCAACTTCCTGGCATACTGTGGAGGACACGTAT[C/T]GAGCTCCTCCCATTGATCGTTCCATCCTGCCAACTGCGCCCCGTGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021520 Essential Splice Site 327 569 8 13
ENSDART00000045775 Essential Splice Site 327 632 8 15
ENSDART00000127365 None None 128 None 5
ENSDART00000128308 Essential Splice Site 327 632 8 15

The following transcripts of ENSDARG00000010194 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 39000805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCTTTGGAGATAGRGAGGAMAGGAGGGATGAAGGCAGAGAAGAGAGGG[G/A]TAGATTGAAACACTAAAGATACAACTTAATCAAAAKTGTAGCACGTCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hdw17qcr