pax3a

Ensembl ID:
ENSDARG00000010192
ZFIN ID:
ZDB-GENE-980526-52
Description:
paired box protein Pax-3 [Source:RefSeq peptide;Acc:NP_571352]
Human Orthologue:
PAX3
Human Description:
paired box 3 [Source:HGNC Symbol;Acc:8617]
Mouse Orthologue:
Pax3
Mouse Description:
paired box gene 3 Gene [Source:MGI Symbol;Acc:MGI:97487]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33020 Essential Splice Site Available for shipment Available now
sa39931 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014350 Essential Splice Site 29 445 2 9
ENSDART00000038828 Essential Splice Site 29 509 2 8
Genomic Location (Zv9):
Chromosome 2 (position 47582162)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47577636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTAGCTTGCATACAATGTCATTCGCTGACTTTTCCTCTTTTGTTGCA[G/A]TCTCTACGCCTTTAGGTCAGGGCCGCGTGAACCAGCTCGGCGGAGTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014350   None 445 None 9
ENSDART00000038828 Nonsense 498 509 8 8
Genomic Location (Zv9):
Chromosome 2 (position 47632094)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47527704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTGAATACCAGCACTGTTACTACTGTAGAAAGACTGTCACGTGTTTA[T/A]CCTCTAAAAAGGGCTTCATTTGGATTGGTGGAATAAAGCAAAATATTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Facial morphology: Genome-wide association study of three-dimensional facial morphology identifies a variant in PAX3 associated with nasion position. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link