ttc39c

Ensembl ID:
ENSDARG00000010191
ZFIN ID:
ZDB-GENE-050522-194
Description:
Tetratricopeptide repeat protein 39C [Source:UniProtKB/Swiss-Prot;Acc:Q1LXE6]
Human Orthologue:
TTC39C
Human Description:
tetratricopeptide repeat domain 39C [Source:HGNC Symbol;Acc:26595]
Mouse Orthologue:
Ttc39c
Mouse Description:
tetratricopeptide repeat domain 39C Gene [Source:MGI Symbol;Acc:MGI:1919997]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24128 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19285 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9410 Essential Splice Site Available for shipment Available now
sa16055 Nonsense Available for shipment Available now
sa12531 Nonsense Available for shipment Available now
sa24127 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105675 Essential Splice Site None 579 1 15
ENSDART00000129310 Essential Splice Site None 275 1 7
ENSDART00000136846 Essential Splice Site None 275 1 7
Genomic Location:
Chromosome 22 (position 16599597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCATACAAATGCGAGTCATTCCAGCGGTCTGCCGTGCGTTTTATTG[G/A]TAAGCGAAATATCATTTCAGTCGGTAATTTGTTTATTCGGCGCGCGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105675 Essential Splice Site 48 579 3 15
ENSDART00000129310 Essential Splice Site 48 275 3 7
ENSDART00000136846 Essential Splice Site 48 275 3 7
ENSDART00000105675 Essential Splice Site 48 579 3 15
ENSDART00000129310 Essential Splice Site 48 275 3 7
ENSDART00000136846 Essential Splice Site 48 275 3 7
Genomic Location:
Chromosome 22 (position 16593757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTATTTCATGAAGACTTGCCTTATCCCATGCTTCTCTATTCTGTCTTC[A/C]GGACCCATAGTCCACTGATGAGCTTCGGTGCCAGTTTTGTCAGCTTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105675 Essential Splice Site 48 579 3 15
ENSDART00000129310 Essential Splice Site 48 275 3 7
ENSDART00000136846 Essential Splice Site 48 275 3 7
ENSDART00000105675 Essential Splice Site 48 579 3 15
ENSDART00000129310 Essential Splice Site 48 275 3 7
ENSDART00000136846 Essential Splice Site 48 275 3 7
Genomic Location:
Chromosome 22 (position 16593757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTATTTCATGAAGACTTGCCTTATCCCATGCTTYTCTATTCTGTCTTC[A/C]GGACCCATAGTCCACTGATGAGCKTCGGTGCCAGTTTTGTCAGCTTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105675 Nonsense 244 579 6 15
ENSDART00000129310 Nonsense 244 275 6 7
ENSDART00000136846 Nonsense 244 275 6 7
Genomic Location:
Chromosome 22 (position 16588803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWATGGTGCCTCCACAYCTGCTGAAGATTGTGAACCTGCTGGGCTTCCCT[G/T]GAGATCGACACCAGGGTCTGGCCTCTTTAGCGTATGCCAGCGAGAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105675 Nonsense 383 579 9 15
ENSDART00000129310 None None 275 None 7
ENSDART00000136846 None None 275 None 7
Genomic Location:
Chromosome 22 (position 16580001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGCCTTCAGGTCATTCGAGCGGCTGAAGAACGAGTCCCGATGGTCA[C/T]AGTGTTATTATGCTTACCTCACCGGAGGTCAGATCAYACCCTTTCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105675 Essential Splice Site 428 579 10 15
ENSDART00000129310 None None 275 None 7
ENSDART00000136846 None None 275 None 7
Genomic Location:
Chromosome 22 (position 16579782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTTCAAACGCAAAAACAATCAGATTGAGCAGTTTGCATTGAAAAGAG[T/C]GAGCTTTCTGCTTTAAGTAGTTTCACTTAAACATTCATAGATAAAAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0h0nz9sw