myo3a

Ensembl ID:
ENSDARG00000010186
ZFIN ID:
ZDB-GENE-041026-4
Description:
myosin-IIIa [Source:RefSeq peptide;Acc:NP_991142]
Human Orthologue:
MYO3A
Human Description:
myosin IIIA [Source:HGNC Symbol;Acc:7601]
Mouse Orthologue:
Myo3a
Mouse Description:
myosin IIIA Gene [Source:MGI Symbol;Acc:MGI:2183924]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13131 Nonsense Available for shipment Available now
sa18647 Nonsense Available for shipment Available now
sa16564 Essential Splice Site Available for shipment Available now
sa3278 Nonsense F2 line generated During 2014
sa5701 Nonsense F2 line generated During 2014
sa6756 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006636 Nonsense 427 1775 13 39
ENSDART00000136041 Nonsense 427 1775 13 38
ENSDART00000006636 Nonsense 427 1775 13 39
ENSDART00000136041 Nonsense 427 1775 13 38
Genomic Location:
Chromosome 24 (position 6298237)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGAACATCAAACCCYCCACATATATATGCWGTGGCAGACATTGCGTA[T/A]CAGTCCATGGTGTCCTATAATGCAGATCAGGTAGAGCATGTTCCTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006636 Nonsense 427 1775 13 39
ENSDART00000136041 Nonsense 427 1775 13 38
ENSDART00000006636 Nonsense 427 1775 13 39
ENSDART00000136041 Nonsense 427 1775 13 38
Genomic Location:
Chromosome 24 (position 6298237)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGAACATCAAACCCYCCACATATATATGCWGTGGCAGACATTGCGTA[T/A]CAGTCCATGGTGTCCTATAATGCAGATCAGRTAGAGCATGTTCCTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006636 Essential Splice Site 437 1775 13 39
ENSDART00000136041 Essential Splice Site 437 1775 13 38
Genomic Location:
Chromosome 24 (position 6298206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGTGGCAGACATTGCGTAWCAGTCCATGGTGTCCTATAATGCAGATCAG[G/A]TAGAGCATGTTCCTCTGTGAGCTGYTGGAGTGTGTCAGTCATAGTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3278
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006636 Nonsense 483 1775 15 39
ENSDART00000136041 Nonsense 483 1775 15 38
ENSDART00000006636 Nonsense 483 1775 15 39
ENSDART00000136041 Nonsense 483 1775 15 38
Genomic Location:
Chromosome 24 (position 6297589)
KASP Assay ID:
554-3384.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACAATCGGACCCTCCAGGAGAAGATTTTGCTGGTTAACAGTCTRGTC[G/T]AGGCATTCGGAAATGCCTGCACTGTGATCAATGATAACTCCAGTCGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5701
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006636 Nonsense 483 1775 15 39
ENSDART00000136041 Nonsense 483 1775 15 38
ENSDART00000006636 Nonsense 483 1775 15 39
ENSDART00000136041 Nonsense 483 1775 15 38
Genomic Location:
Chromosome 24 (position 6297589)
KASP Assay ID:
554-3384.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACAATCGGACCCTCCAGGAGAAGATTTTGCTGGTTAACAGTCTRGTC[G/T]AGGCATTCGGAAATGCCTGCACTGTGATCAATGATAACTCCAGTCGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006636 Essential Splice Site 1677 1775 36 39
ENSDART00000136041 Essential Splice Site 1677 1775 36 38
Genomic Location:
Chromosome 24 (position 6254333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTACAGAGGTCTGTCCAGGAYGATAAAAGGAGGCCGCGGAAACAAAGG[T/A]AATTCTATTAGCAGAAGTTTTATGCTAGAGANNNNNNNNNNTTCCCCTTTAGAGAAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e4fort22