asap2a

Ensembl ID:
ENSDARG00000010181
ZFIN ID:
ZDB-GENE-041210-256
Description:
arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 2 [Source:RefSeq peptide;Acc:N
Human Orthologue:
ASAP2
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:2721]
Mouse Orthologue:
6530401G17Rik
Mouse Description:
RIKEN cDNA 6530401G17 gene Gene [Source:MGI Symbol;Acc:MGI:1923478]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11846 Nonsense Available for shipment Available now
sa4721 Nonsense Mutation detected in F1 DNA During 2014
sa23132 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026152 Nonsense 52 991 2 28
Genomic Location:
Chromosome 17 (position 35310033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTYTCTGTGTGTGTGTTTAGGCCCTGGATGTGGACCGCAGTGTCCTTTA[C/A]AAGATGAAGAAGTCAGTTAAGGCTATTTACGCCTCGGGTCTGGGTAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026152 Nonsense 564 991 17 28
Genomic Location:
Chromosome 17 (position 35370481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACACGCTCTGTGATGCTGTGAAGGCCCGGGACATTTTCTCTCTCATC[C/T]AGGTCTATGCTGAAGGAGTGGATCTGATGGAGCCCATTCCTCTGGCYAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026152 Essential Splice Site 874 991 24 28
Genomic Location:
Chromosome 17 (position 35382928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACCCGGACAGGGGCCTCCTGGACAGAACATCAACCGGGCTACAAGG[T/C]CAGATTAACAAATAACCCATTACCACAAGCACACACTCTAATATACTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k7gb12ns