LOC565885

Ensembl ID:
ENSDARG00000010158
Human Orthologue:
NBEA
Human Description:
neurobeachin [Source:HGNC Symbol;Acc:7648]
Mouse Orthologue:
Nbea
Mouse Description:
neurobeachin Gene [Source:MGI Symbol;Acc:MGI:1347075]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22688 Nonsense Available for shipment Available now
sa14121 Nonsense Available for shipment Available now
sa35947 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa42587 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12695 Nonsense Available for shipment Available now
sa42588 Nonsense Mutation detected in F1 DNA During 2016
sa35948 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Nonsense 180 2883 3 56
Genomic Location (Zv9):
Chromosome 15 (position 32554127)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33462420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTTTTCCAGACTTGCTGGTGGATATGCTTGGAGTTCTGGCCAGCTA[C/A]AGTATCACCGTCAAAGAACTCAAACTGCTCTTCAGCATGCTGAGAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Nonsense 399 2883 8 56
Genomic Location (Zv9):
Chromosome 15 (position 32570534)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33446013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TSTATGTGTTCAGTGAARCTCTAAACCCAGCTCAGATATTTGCCATCCAT[C/T]AAYTGGGCCCAGGATACAAGGTATGTATCAGATTCGCCAAAGTGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Splice Site, Nonsense 517 2883 11 56
Genomic Location (Zv9):
Chromosome 15 (position 32593088)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33423459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTACCCTGTAAAGCTGTGAAAATTTATTTTATTTTTTTCTGTGCAGTT[C/A]AACTCTCCTCGCCTTCCTGATGGAGCTACTCAAGAGCTCGGTGGCAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Essential Splice Site 1382 2883 24 56
Genomic Location (Zv9):
Chromosome 15 (position 32655062)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33361485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCTGTGGAGGAATCCTTCCCCTGCTGTCCGCCGCCACTTCTCCTTCT[G/A]TGAGTGAGCCAGAGCTTTGACCACACTGACACACGGTGGCCATTGTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Nonsense 1703 2883 29 56
Genomic Location (Zv9):
Chromosome 15 (position 32671669)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33344878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGGTGGAGACCACAGAGAGKGGGACAGAGSCCCTGCCGTATCCCGAA[C/T]AGCAGGCCATGAAGAGGGAAGCACAGRCCATGWTGCCCATGCAGTTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Nonsense 1892 2883 34 56
Genomic Location (Zv9):
Chromosome 15 (position 32731621)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33284926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAGTGGCAGAACTCGATTCAGAAGAACGCTGGCCTGGCTTTCATT[G/T]AGCTGATCAACGAGGGAAGGTAAAGTCACACGTCTTCTCCTAAACCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Essential Splice Site 2373 2883 45 56
Genomic Location (Zv9):
Chromosome 15 (position 32894138)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33122413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCCCGCTCGTGGAGGCACTGCCAGCGCGATACTGCAGATGTGAAGG[T/A]AATCAGATAGCAGGTTTTATATGTTATAATGTCTTGGAAACTAGTCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link