LOC565885

Ensembl ID:
ENSDARG00000010158
Human Orthologue:
NBEA
Human Description:
neurobeachin [Source:HGNC Symbol;Acc:7648]
Mouse Orthologue:
Nbea
Mouse Description:
neurobeachin Gene [Source:MGI Symbol;Acc:MGI:1347075]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22688 Nonsense Mutation detected in F1 DNA During 2014
sa14121 Nonsense Available for shipment Available now
sa7766 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12695 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Nonsense 180 2883 3 56
Genomic Location:
Chromosome 15 (position 32554127)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTTTTCCAGACTTGCTGGTGGATATGCTTGGAGTTCTGGCCAGCTA[C/A]AGTATCACCGTCAAAGAACTCAAACTGCTCTTCAGCATGCTGAGAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Nonsense 399 2883 8 56
Genomic Location:
Chromosome 15 (position 32570534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TSTATGTGTTCAGTGAARCTCTAAACCCAGCTCAGATATTTGCCATCCAT[C/T]AAYTGGGCCCAGGATACAAGGTATGTATCAGATTCGCCAAAGTGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Essential Splice Site 660 2883 13 56
Genomic Location:
Chromosome 15 (position 32602996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCTGTGAACCCAAACAACACCAGCGGCATCACRCCTAAAGGACTGGG[T/A]CAGTACGCACACGCACSATCACACGTTTTTGTTGGTGGCCTACAGGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041157 Nonsense 1703 2883 29 56
Genomic Location:
Chromosome 15 (position 32671669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGGTGGAGACCACAGAGAGKGGGACAGAGSCCCTGCCGTATCCCGAA[C/T]AGCAGGCCATGAAGAGGGAAGCACAGRCCATGWTGCCCATGCAGTTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cenaijrm