abi1a

Ensembl ID:
ENSDARG00000010155
ZFIN ID:
ZDB-GENE-040426-1701
Description:
abl-interactor 1a [Source:RefSeq peptide;Acc:NP_957032]
Human Orthologue:
ABI1
Human Description:
abl-interactor 1 [Source:HGNC Symbol;Acc:11320]
Mouse Orthologue:
Abi1
Mouse Description:
abl-interactor 1 Gene [Source:MGI Symbol;Acc:MGI:104913]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24441 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031245 Essential Splice Site 27 274 5 10
ENSDART00000127697 Essential Splice Site 236 517 5 11
ENSDART00000131768 Essential Splice Site 236 483 5 10
Genomic Location:
Chromosome 24 (position 6071376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGTCCAGGACGAACTGCATCTCTTAACCAGAGACCGAGAACACACAG[G/A]TAACACAGCAAACTGACTTACTGAAATTCATCAACCGAAGCATTTAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ggavwidz