cpa2

Ensembl ID:
ENSDARG00000010146
ZFIN ID:
ZDB-GENE-040801-182
Description:
carboxypeptidase A2 (pancreatic) [Source:RefSeq peptide;Acc:NP_001003446]
Human Orthologues:
CPA2, CPA4
Human Descriptions:
carboxypeptidase A2 (pancreatic) [Source:HGNC Symbol;Acc:2297]
carboxypeptidase A4 [Source:HGNC Symbol;Acc:15740]
Mouse Orthologues:
Cpa2, Cpa4
Mouse Descriptions:
carboxypeptidase A2, pancreatic Gene [Source:MGI Symbol;Acc:MGI:3617840]
carboxypeptidase A4 Gene [Source:MGI Symbol;Acc:MGI:1919041]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24634 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011397 Essential Splice Site 234 422 8 11
Genomic Location:
Chromosome 25 (position 16952423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAAGTTTCACAGTATTTCTAATGACATTACAAACTAATGACCCCTT[A/T]GCCGTTTCACCGTTTGTGGCGTAAGAGCCGGTCTGTGACCTCTAACCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jlikpv7n