cpa2

Ensembl ID:
ENSDARG00000010146
ZFIN ID:
ZDB-GENE-040801-182
Description:
carboxypeptidase A2 (pancreatic) [Source:RefSeq peptide;Acc:NP_001003446]
Human Orthologues:
CPA2, CPA4
Human Descriptions:
carboxypeptidase A2 (pancreatic) [Source:HGNC Symbol;Acc:2297]
carboxypeptidase A4 [Source:HGNC Symbol;Acc:15740]
Mouse Orthologues:
Cpa2, Cpa4
Mouse Descriptions:
carboxypeptidase A2, pancreatic Gene [Source:MGI Symbol;Acc:MGI:3617840]
carboxypeptidase A4 Gene [Source:MGI Symbol;Acc:MGI:1919041]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24634 Essential Splice Site Mutation detected in F1 DNA During 2015
sa30224 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa24634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011397 Essential Splice Site 234 422 8 11
Genomic Location:
Chromosome 25 (position 16952423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAAGTTTCACAGTATTTCTAATGACATTACAAACTAATGACCCCTT[A/T]GCCGTTTCACCGTTTGTGGCGTAAGAGCCGGTCTGTGACCTCTAACCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011397 Essential Splice Site 265 422 8 11
Genomic Location:
Chromosome 25 (position 16952324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGCCCTGGTGTCGACCTCAACAGAAACTTTGATGCTGAATTTAGTG[G/C]TACGTTCAACTTCATACTGATATTTTTGACACATTAGAAGGTATTTACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jlikpv7n