lppr3a

Ensembl ID:
ENSDARG00000010144
ZFIN ID:
ZDB-GENE-070912-555
Description:
lipid phosphate phosphatase-related protein type 3a [Source:RefSeq peptide;Acc:NP_001164499]
Human Orthologue:
MIR3187
Human Description:
microRNA 3187 [Source:HGNC Symbol;Acc:38319]
Mouse Orthologue:
BC005764
Mouse Description:
cDNA sequence BC005764 Gene [Source:MGI Symbol;Acc:MGI:2388640]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9264 Nonsense Mutation detected in F1 DNA During 2014
sa25110 Nonsense Mutation detected in F1 DNA During 2014
sa19767 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Nonsense 82 730 3 8
Genomic Location:
Chromosome 2 (position 26344921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCCAAAGTGGGTTTCCGGTGCCACGACCGCACACTGAGCATGCCCTA[T/A]GTGGAAACGGGAGACGAGCTCATCCCTCTGCTCATGCTGCTCAGCCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Nonsense 232 730 6 8
Genomic Location:
Chromosome 2 (position 26351660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTTTCCCCTCCCAGCACGCAACTCTGTCTGGCTTCGCAGCCGTCTA[C/A]ATCTCTGTAAGCATTTCCCTTTACTTTGATTTCACAATAATCTGATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Essential Splice Site 293 730 8 8
Genomic Location:
Chromosome 2 (position 26354991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAGTAGATTTACATTAACCTTTAAATTACAACTGTTTCTCACACTCC[A/C]GGCACTGTATGCAGTGGGGAACTTTAGATCCAACGAGGAAGCCTCCCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9jj5ewyb