lppr3a

Ensembl ID:
ENSDARG00000010144
ZFIN ID:
ZDB-GENE-070912-555
Description:
lipid phosphate phosphatase-related protein type 3a [Source:RefSeq peptide;Acc:NP_001164499]
Human Orthologue:
MIR3187
Human Description:
microRNA 3187 [Source:HGNC Symbol;Acc:38319]
Mouse Orthologue:
BC005764
Mouse Description:
cDNA sequence BC005764 Gene [Source:MGI Symbol;Acc:MGI:2388640]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30595 Nonsense Mutation detected in F1 DNA During 2016
sa9264 Nonsense Mutation detected in F1 DNA During 2016
sa25110 Nonsense Mutation detected in F1 DNA During 2016
sa19767 Essential Splice Site Available for shipment Available now
sa25814 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Nonsense 17 730 2 8
Genomic Location (Zv9):
Chromosome 2 (position 26340173)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26536369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCTTATTTTGACTGTATTTGTTTTCAGATTTTACCCGACCCAACAGC[A/T]AAATGATGTCTCCAAAAGACAAGCCCAAGAAGAAGCCTCCCAAAGACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Nonsense 82 730 3 8
Genomic Location (Zv9):
Chromosome 2 (position 26344921)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26541117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCCAAAGTGGGTTTCCGGTGCCACGACCGCACACTGAGCATGCCCTA[T/A]GTGGAAACGGGAGACGAGCTCATCCCTCTGCTCATGCTGCTCAGCCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Nonsense 232 730 6 8
Genomic Location (Zv9):
Chromosome 2 (position 26351660)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26547856
KASP Assay ID:
554-7309.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTTTCCCCTCCCAGCACGCAACTCTGTCTGGCTTCGCAGCCGTCTA[C/A]ATCTCTGTAAGCATTTCCCTTTACTTTGATTTCACAATAATCTGATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Essential Splice Site 293 730 8 8
Genomic Location (Zv9):
Chromosome 2 (position 26354991)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26551187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAGTAGATTTACATTAACCTTTAAATTACAACTGTTTCTCACACTCC[A/C]GGCACTGTATGCAGTGGGGAACTTTAGATCCAACGAGGAAGCCTCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024662 Nonsense 431 730 8 8
Genomic Location (Zv9):
Chromosome 2 (position 26355409)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26551605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATGTGTCGATGGACACTCAGCGCTCCAAACAGCTGGTGTCCGAATG[G/A]AAGCAGAAATCAATAGAGATGCGTAGTCTCAGCCTCAGGGACGAGGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link