ldb1a

Ensembl ID:
ENSDARG00000010137
ZFIN IDs:
ZDB-GENE-990415-135, ZDB-GENE-990415-138
Description:
LIM domain-binding protein 1-A [Source:UniProtKB/Swiss-Prot;Acc:O73715]
Human Orthologue:
LDB1
Human Description:
LIM domain binding 1 [Source:HGNC Symbol;Acc:6532]
Mouse Orthologue:
Ldb1
Mouse Description:
LIM domain binding 1 Gene [Source:MGI Symbol;Acc:MGI:894762]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38946 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35507 Nonsense Available for shipment Available now
sa42216 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002698 Essential Splice Site 127 359 None 11
ENSDART00000015773 Essential Splice Site 83 374 None 11
ENSDART00000126845 Essential Splice Site 82 375 None 11

The following transcripts of ENSDARG00000010137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 28961735)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28607683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCCTGTACATTAATTCTGTACTGAAACCAAATTTTTTTCTTGATTTC[A/T]GCTATTGGGAGAACGTTGATCCCTCGGTACTTCAGGAGTATTTTTGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002698 Nonsense 305 359 10 11
ENSDART00000015773 Nonsense 261 374 10 11
ENSDART00000126845 Nonsense 260 375 10 11

The following transcripts of ENSDARG00000010137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 28966314)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28612262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGATCTGTCTCTCTTCAGCCGAGCCAGCAAGACAAGCCCCCAACAAG[C/T]GAAGGAAACGAAAAATGTCCGGCGGGAGCACAATGAGTTCTGGAGGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002698   None 359 None 11
ENSDART00000015773 Nonsense 328 374 11 11
ENSDART00000126845 Nonsense 329 375 11 11

The following transcripts of ENSDARG00000010137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 28967002)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28612950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGTTCGGGGACGAGGATGAGCGGCTCATCACACGGCTGGAGAACACA[C/T]AGTTTGATGCGGCCAATGGCATCGACGACGAGGACAGTTTCAACAGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link