dacha

Ensembl ID:
ENSDARG00000010132
ZFIN ID:
ZDB-GENE-020402-3
Description:
dachshund homolog 2 [Source:RefSeq peptide;Acc:NP_694487]
Human Orthologue:
DACH2
Human Description:
dachshund homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:16814]
Mouse Orthologue:
Dach2
Mouse Description:
dachshund 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890446]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15153 Nonsense Available for shipment Available now
sa1156 Nonsense Available for shipment Available now
sa9931 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023038 Nonsense 150 602 1 12
ENSDART00000136081   None 428 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 33623487)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34623180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAWTCAGCCGGGCGTGAACCGGTGCAAACTCATCACCCGAAAAGACTTC[G/T]AGACACTTTATAACGACTGCACCAATGCCAGGCAAGTCTTAAATCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023038 Nonsense 408 602 7 12
ENSDART00000136081 Nonsense 234 428 7 12
Genomic Location (Zv9):
Chromosome 21 (position 33387418)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34387111
KASP Assay ID:
554-1067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNATTCTCATATCTGCAGTTTTGAACCCGACTGATGGAGATCTGCCAGAA[C/T]GAGACACCGGCATCAATATGAAGAAAATGCTTAAGGAGAAAGGTTAGTGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023038 Nonsense 552 602 10 12
ENSDART00000136081 Nonsense 378 428 10 12
Genomic Location (Zv9):
Chromosome 21 (position 33353959)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34353652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGCAGGAGGCTCTGGAGTTTGAATCCAAGAGGAGAGAGCAGGTGGAA[C/T]AGGCTCTCAAACAGGCCACTTCTCCTGAGAGTCTCCGCWTGAGTCTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link