p4ha2

Ensembl ID:
ENSDARG00000010085
ZFIN ID:
ZDB-GENE-030827-1
Description:
prolyl 4-hydroxylase subunit alpha-2 [Source:RefSeq peptide;Acc:NP_001007286]
Human Orthologue:
P4HA2
Human Description:
prolyl 4-hydroxylase, alpha polypeptide II [Source:HGNC Symbol;Acc:8547]
Mouse Orthologue:
P4ha2
Mouse Description:
procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide Gene

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10597 Nonsense Available for shipment Available now
sa44975 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024137 Nonsense 224 514 6 14
ENSDART00000122352 Nonsense 118 408 2 10
ENSDART00000129566 Nonsense 227 541 5 14
Genomic Location (Zv9):
Chromosome 21 (position 41520855)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43120194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCTGGATTATCTCAGTTACTCTGTCTATCAGATGGGGGATCTGCCA[C/T]GAGCCATCGAGCTTACCAGACGCCTGCTRGCCATCGGTAACCGCAGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024137 Nonsense 307 514 8 14
ENSDART00000122352 Nonsense 201 408 4 10
ENSDART00000129566 Nonsense 310 541 7 14
Genomic Location (Zv9):
Chromosome 21 (position 41517411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTATAAAACATTTTTTCCTCTTTATCTCCTGCAGACTACTAAGAGG[C/T]AGAGCCGGCTGTTCTGTCGCTATCGTGATGGAAACCGAAATCCCCGTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link