nup133

Ensembl ID:
ENSDARG00000010078
ZFIN ID:
ZDB-GENE-040426-2941
Description:
nuclear pore complex protein Nup133 [Source:RefSeq peptide;Acc:NP_998696]
Human Orthologue:
NUP133
Human Description:
nucleoporin 133kDa [Source:HGNC Symbol;Acc:18016]
Mouse Orthologue:
Nup133
Mouse Description:
nucleoporin 133 Gene [Source:MGI Symbol;Acc:MGI:2442620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18482 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020680 Essential Splice Site 828 1136 19 26
ENSDART00000139388 Essential Splice Site 268 576 6 13
Genomic Location (Zv9):
Chromosome 1 (position 54503450)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53276953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WTGAGTGAAAAAATGACCTGAATGTATKYGTGTTGTGTTTGTGTCGAGCA[G/A]TGGAGTTGGGTCAGCATCAGTGGGTTGCAGCGCTGGCMGAAAAATACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link