PTCHD3 (1 of 2)

Ensembl ID:
ENSDARG00000010075
Description:
patched domain containing 3 [Source:HGNC Symbol;Acc:24776]
Human Orthologue:
PTCHD3
Human Description:
patched domain containing 3 [Source:HGNC Symbol;Acc:24776]
Mouse Orthologue:
Ptchd3
Mouse Description:
patched domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1921925]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24526 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020982 Nonsense 123 830 1 4
Genomic Location (Zv9):
Chromosome 24 (position 33772867)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32652794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCACAGACGCTGCTTTTCGGGAGATAGTGATTTTAGACAGGAAAGTC[A/T]AGGAGCTGAATGTGTCCACGGGTCACGAGGTGCTTACTTTTGAGGGACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link