adam9

Ensembl ID:
ENSDARG00000010070
ZFIN ID:
ZDB-GENE-040912-127
Description:
a disintegrin and metalloproteinase domain 9 [Source:RefSeq peptide;Acc:NP_001004678]
Human Orthologue:
ADAM9
Human Description:
ADAM metallopeptidase domain 9 [Source:HGNC Symbol;Acc:216]
Mouse Orthologue:
Adam9
Mouse Description:
a disintegrin and metallopeptidase domain 9 (meltrin gamma) Gene [Source:MGI Symbol;Acc:MGI:105376]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1421 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040066 Essential Splice Site 80 271 4 10
ENSDART00000132297 Essential Splice Site 80 816 4 23
ENSDART00000132810 None None 73 None 3

The following transcripts of ENSDARG00000010070 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 48061006)
KASP Assay ID:
554-1342.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAACAACGAATGCTCACATAGTTTTATGTTTGTTTGTTTTTTCCTA[G/A]ATTGCTACTTCCAGAAGACTTCACTRTGTACTCTTATGCCAAAGATGGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/64pz1ngl