ndrg3b

Ensembl ID:
ENSDARG00000010052
ZFIN ID:
ZDB-GENE-030131-5606
Description:
N-myc downstream regulated family member 3b [Source:RefSeq peptide;Acc:NP_956091]
Human Orthologue:
NDRG3
Human Description:
NDRG family member 3 [Source:HGNC Symbol;Acc:14462]
Mouse Orthologue:
Ndrg3
Mouse Description:
N-myc downstream regulated gene 3 Gene [Source:MGI Symbol;Acc:MGI:1352499]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24278 Nonsense Available for shipment Available now
sa32432 Essential Splice Site Available for shipment Available now
sa18512 Essential Splice Site Available for shipment Available now
sa10361 Essential Splice Site Available for shipment Available now
sa25194 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010258 Nonsense 6 371 2 16
ENSDART00000144965 Nonsense 6 371 2 16
ENSDART00000147799 Nonsense 6 148 2 7

The following transcripts of ENSDARG00000010052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15030229)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15162162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTTTCTAGTGACGGGCAGCTGTCAGGCTTGATGATGGATGAGTTA[C/T]AGGATGTGCAGTTGACCGAGATCAAACCCCTCTTGACGGACAAGGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010258 Essential Splice Site 253 371 None 16
ENSDART00000144965 Essential Splice Site 253 371 None 16
ENSDART00000147799   None 148 None 7

The following transcripts of ENSDARG00000010052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14965171)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15097104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAGGCCCGTTCTGGGAATGAACGAAAATGCAGTTAAAACGCTGAAG[T/C]AGGTTCATTGGTTGTCTTTTTCTTTTTAGGGTGTCTTTTAAAATGTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010258 Essential Splice Site 270 371 None 16
ENSDART00000144965 Essential Splice Site 270 371 None 16
ENSDART00000147799   None 148 None 7
ENSDART00000010258 Essential Splice Site 270 371 None 16
ENSDART00000144965 Essential Splice Site 270 371 None 16
ENSDART00000147799   None 148 None 7

The following transcripts of ENSDARG00000010052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14963568)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15095501
KASP Assay ID:
2261-7465.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCCYTGCTGATTGTTGGAGACACATCACCAGCGGTAGAGGCTGTGG[T/G]GAGTGACTAATCAAAAAANTGACCTGTTACGTCTACTGGCAMKGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010258 Essential Splice Site 270 371 None 16
ENSDART00000144965 Essential Splice Site 270 371 None 16
ENSDART00000147799   None 148 None 7
ENSDART00000010258 Essential Splice Site 270 371 None 16
ENSDART00000144965 Essential Splice Site 270 371 None 16
ENSDART00000147799   None 148 None 7

The following transcripts of ENSDARG00000010052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14963568)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15095501
KASP Assay ID:
2261-7465.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCCYTGCTGATTGTTGGAGACACATCACCAGCGGTAGAGGCTGTGG[T/G]GAGTGACTAATCAAAAAANTGACCTGTTACGTCTACTGGCAMKGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010258 Nonsense 350 371 16 16
ENSDART00000144965 Nonsense 350 371 16 16
ENSDART00000147799   None 148 None 7

The following transcripts of ENSDARG00000010052 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14945724)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15077657
KASP Assay ID:
554-7480.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCATGGGCTCAGGGGACGGTTCGCGCAGCCGCACACAGACCAGTTCA[C/T]AGATGGAGGGCGCCACTGGCGGCCCCGCCCTCGACAACCAGAACAGAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link