lsrl

Ensembl ID:
ENSDARG00000010025
ZFIN ID:
ZDB-GENE-050913-73
Description:
lipolysis-stimulated lipoprotein receptor [Source:RefSeq peptide;Acc:NP_001020643]
Human Orthologue:
LSR
Human Description:
lipolysis stimulated lipoprotein receptor [Source:HGNC Symbol;Acc:29572]
Mouse Orthologue:
Lsr
Mouse Description:
lipolysis stimulated lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:1927471]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8876 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015967 Nonsense 113 599 2 10
ENSDART00000110805 Nonsense 113 199 2 11
ENSDART00000122561 Nonsense 113 594 2 10
ENSDART00000142074 Nonsense 113 199 2 5

The following transcripts of ENSDARG00000010025 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 31913914)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCGCATAGTCGCTTCCAAACAAACRGCCGTCACGCTTGGAAAAGAGTA[T/A]CAGGGCCGTCAGATCAGCATCACAAATAGTAAGTNAAAAAAGATGCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ga8881ge