grpel1

Ensembl ID:
ENSDARG00000010021
ZFIN ID:
ZDB-GENE-051120-111
Description:
grpE protein homolog 1, mitochondrial [Source:RefSeq peptide;Acc:NP_001032461]
Human Orthologue:
GRPEL1
Human Description:
GrpE-like 1, mitochondrial (E. coli) [Source:HGNC Symbol;Acc:19696]
Mouse Orthologue:
Grpel1
Mouse Description:
GrpE-like 1, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1334417]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21037 Nonsense Available for shipment Available now
sa2354 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa21037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016803 Nonsense 16 217 1 4

The following transcripts of ENSDARG00000010021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41144185)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39480442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATGGCGAACTGGTGCGTGCGCGCGATCAGACACAGCTCTTCAATCT[T/A]AGCGTCCCCTTCACTAGTAAGGTATGTTTCAGCTTTGCTAAGGCGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2354
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016803 Nonsense 66 217 2 4

The following transcripts of ENSDARG00000010021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41141587)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39477844
KASP Assay ID:
554-2669.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCAAGAGCCTGGCACAGCTGAAAAAGCCTTCTTAGAAGAAAAGACA[C/T]AACTGGAGGAGCAACTAAAAGATGTTACGGTAAAGCTGCATTCAATTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link