gna11

Ensembl ID:
ENSDARG00000010002
ZFIN ID:
ZDB-GENE-050208-597
Description:
guanine nucleotide binding protein (G protein), alpha 11 (Gq class) [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
GNA11
Human Description:
guanine nucleotide binding protein (G protein), alpha 11 (Gq class) [Source:HGNC Symbol;Acc:4379]
Mouse Orthologue:
Gna11
Mouse Description:
guanine nucleotide binding protein, alpha 11 Gene [Source:MGI Symbol;Acc:MGI:95766]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5692 Essential Splice Site F2 line generated During 2017
sa3183 Essential Splice Site F2 line generated During 2017
sa3194 Nonsense F2 line generated During 2017
sa5691 Nonsense F2 line generated During 2017
sa37508 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5692
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105566 Essential Splice Site 107 359 2 7
ENSDART00000136795 Essential Splice Site 105 400 2 8
ENSDART00000105566 Essential Splice Site 107 359 None 7
ENSDART00000136795 Essential Splice Site 105 400 None 8
Genomic Location (Zv9):
Chromosome 22 (position 22191089)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21844337
KASP Assay ID:
554-3147.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCGCCACCGAGCACCTCAAGATCCCATTCAGATTCGAAGACAACAAGG[T/A]GAGCGCTGCACACTTACAATCCCAGCCCTTATCATCGCTTTGATGCGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3183
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105566 Essential Splice Site 107 359 2 7
ENSDART00000136795 Essential Splice Site 105 400 2 8
ENSDART00000105566 Essential Splice Site 107 359 None 7
ENSDART00000136795 Essential Splice Site 105 400 None 8
Genomic Location (Zv9):
Chromosome 22 (position 22191089)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21844337
KASP Assay ID:
554-3147.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCGCCACCGAGCACCTCAAGATCCCATTCAGATTCGAAGACAACAAGG[T/A]GAGCGCTGCACACTTACAATCCCAGCCCTTATCATCGCTTTGATGCGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3194
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105566 Nonsense 128 359 3 7
ENSDART00000136795 Nonsense 126 400 3 8
ENSDART00000105566 Nonsense 128 359 3 7
ENSDART00000136795 Nonsense 126 400 3 8
Genomic Location (Zv9):
Chromosome 22 (position 22190667)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21843915
KASP Assay ID:
554-3403.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGCGAGAGGTCGATGTCGAGAAGGTTTGCTCTTTTGAACAGCCCTA[T/A]GTTGCTGCAATTAATAAGCTCTGGATGGATCCGGGCATCCAGGAAGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5691
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105566 Nonsense 128 359 3 7
ENSDART00000136795 Nonsense 126 400 3 8
ENSDART00000105566 Nonsense 128 359 3 7
ENSDART00000136795 Nonsense 126 400 3 8
Genomic Location (Zv9):
Chromosome 22 (position 22190667)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21843915
KASP Assay ID:
554-3403.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGCGAGAGGTCGATGTCGAGAAGGTTTGCTCTTTTGAACAGCCCTA[T/A]GTTGCTGCAATTAATAAGCTCTGGATGGATCCGGGCATCCAGGAAGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105566 Essential Splice Site 159 359 3 7
ENSDART00000136795 Essential Splice Site 157 400 3 8
Genomic Location (Zv9):
Chromosome 22 (position 22190573)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21843821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCATACGACCGCAGGCGAGAGTACCAGCTCTCTGACTCCACTAAATAG[T/C]AAGTGTGTGTGTGTGTGTGTCGTCATTTGCTGCTTTTAGGTTTATTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link