fam199x

Ensembl ID:
ENSDARG00000009982
ZFIN ID:
ZDB-GENE-040808-24
Description:
Protein FAM199X [Source:UniProtKB/Swiss-Prot;Acc:Q6AXJ7]
Human Orthologue:
FAM199X
Human Description:
family with sequence similarity 199, X-linked [Source:HGNC Symbol;Acc:25195]
Mouse Orthologue:
Fam199x
Mouse Description:
family with sequence similarity 199, X-linked Gene [Source:MGI Symbol;Acc:MGI:2384304]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7230 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3899 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003879 Essential Splice Site 129 374 3 7
Genomic Location:
Chromosome 14 (position 10555291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCATTAGYACTTACTGGGATTGGTCAGACAGTGAATTTGAGTGGCAGG[T/G]AAGCCAAATGTTTTTGTTCATATRTAGCTTGATGTTATTTTCTTAACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003879 Nonsense 314 374 6 7
Genomic Location:
Chromosome 14 (position 10546530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCCGTGCACACAGCGATGGAAACCTGGCCACTGCCGCAGAGCGAATA[C/T]GAGACTCAAAGGTACTTTAGGCTRTTTTTCTTTTATGACATCAAGAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2bi6onwc