icn

Ensembl ID:
ENSDARG00000009978
ZFIN ID:
ZDB-GENE-030131-8599
Description:
ictacalcin [Source:RefSeq peptide;Acc:NP_997926]
Human Orthologue:
S100P
Human Description:
S100 calcium binding protein P [Source:HGNC Symbol;Acc:10504]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22831 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004679 Essential Splice Site 5 95 2 3
Genomic Location:
Chromosome 16 (position 25671259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATTATTGTTAATTATAACTAACTCATTTTGTTTCACACAAATTTTGC[A/C]GATACCCAGAAAGCAATGGCTATGCTCATTGCAACCTTCCACAAATACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oy95rswc