mag

Ensembl ID:
ENSDARG00000009965
ZFIN ID:
ZDB-GENE-041217-24
Description:
myelin-associated glycoprotein [Source:RefSeq peptide;Acc:NP_001007063]
Human Orthologue:
MAG
Human Description:
myelin associated glycoprotein [Source:HGNC Symbol;Acc:6783]
Mouse Orthologue:
Mag
Mouse Description:
myelin-associated glycoprotein Gene [Source:MGI Symbol;Acc:MGI:96912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016753 Nonsense 116 653 2 10
ENSDART00000077424 Nonsense 116 635 2 9
Genomic Location:
Chromosome 15 (position 31972255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGCACACTGCTGATAAGTAACATTGGCGTGGAACATTCTGGAAAGTA[T/G]TACTTCAGGGCAGATCTTGGTGGAGCGAATATCTACACTTTTCCTGACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/28p1dbky